Changes

From Genome Analysis Wiki
Jump to: navigation, search

Variant classification

68 bytes added, 20:12, 25 February 2016
Interesting Variant Types
one record with a mix of both repeat types
20 9538695 <span style="color:#FF0000">TATT<span style="color:#0000FF">CATTCATT </span> <span style="color:#0000FF">CATT </span>
 
= Representation of close by variants =
 
CATACTATATATAGCCTCCA
= Output =
1,102
edits

Navigation menu