From Genome Analysis Wiki
Jump to navigationJump to search
135 bytes added
, 19:13, 25 February 2016
Line 115: |
Line 115: |
| A nice useful scheme is +2 for matches and -7 for indels and mismatches, and it provides a convenient way of scoring for purity. | | A nice useful scheme is +2 for matches and -7 for indels and mismatches, and it provides a convenient way of scoring for purity. |
| | | |
− | == Normalized scoring == | + | == Inexact Tandem Repeats == |
| | | |
| + | We see alot of this |
| | | |
| + | AAAAAAAAAAAGAAAAAAAAAAAAAA |
| + | |
| + | or |
| + | |
| + | ACACACACACACGACACACAACACACACACAC |
| + | |
| + | or |
| + | |
| + | GAAAGAAGGAAAAGAGAGAAAAGAAGAAGAA |
| | | |
| = Classification = | | = Classification = |